An and stable transfection. Lentiviral vectors are considered

Anoptimized method for overexpression (Lentiviral Transduction) of specific genesin Human Adipose-Derived Mesenchymal Stem Cells Zohreh Bolandi1, 2…………….

.….HosseinGhanbarian1, 2*1Cellular and Molecular Biology ResearchCenter, Shahid Beheshti University ofMedical Sciences, Tehran, Iran2Department ofBiotechnology, School of Advanced Technologies in Medicine, Shahid BeheshtiUniversity of Medical Sciences, Tehran, Iran   * Corresponding author: Hossein Ghanbarian, PhDBiotechnology DepartmentSchool of Advanced Technologies in MedicineShahid Beheshti University of Medical SciencesTehran, IranPhone: +98 9125996305Fax:     +98 21 22439956E-mail: [email protected]    ABSTRACT Key words:                 INTRODUCTION:Mesenchymalstem cells (MSCs) are multipotent plastic-adherent cells that isolated frommany adult tissues such as adipose, bone marrow, muscle, and umbilical blood.There is no specific surface marker for MSCs characterization but they aredistinguished from hematopoietic stem cells by expressing of CD73, CD90 and,CD105 but the absence of CD14, CD31, CD34, and CD45. MSCs can be differentiatedinto mesoderm lineages, namely adipocytes, osteoblasts, and chondrocytes.

Furthermore, it has been shown these cells have the ability to differentiateinto cardiomyocytes, myocytes, hepatocytes, and neural cells. Due to thisunique property, MSCs are widely used for gene. For this purpose, MSCs wereisolated from adipose tissue, owing to its accessibility and minimalinvasiveness, and then gene of interest was transferred to the cells by viralor nonviral methods. Most of the nonviral transfection methods (e.g.;electroporation, lipofection) have a low efficiency (%??) in transfection ofprimary cells, however viral transfection gives rise to more efficient (up to??%) and stable transfection.Lentiviralvectors are considered as an efficient vehicle to express exogenous genes inMSCs. The current standard method for efficient long-term lentiviraltransduction needs the concentration of virus particles from a large amount ofculture media.

One method to achieve this is ultracentrifugation that requiresexpensive specialized laboratory equipment that is a major drawback inviral transduction. If the procedure were optimized, the cells could betransfected with supernatant directly.Moreover, ithas been well established that polybrene increase viral transduction efficiencydue to its positive charge which reduce negative charges between viral andtarget cell surface. Nevertheless recent studies revealed that polybrene candecrease MSC proliferation and this issue is a major drawback especially ingene therapy, where we needs sufficient cells frompatient (proliferationPARANDCO1  )…… Recent studies showed that liposomalPARANDCO2  component could increase transductionefficiency of viral vectors by encapsulation of whole negatively charged viralparticles and introduce them to the cell surface because of positive charges.The object of this study was to evaluate optimized method for stablytransfection of AD-MSCs with lentiviral vector without using ultracentrifugeand polybrene. 2. MATERIALSAND METHODS:2.

Best services for writing your paper according to Trustpilot

Premium Partner
From $18.00 per page
4,8 / 5
4,80
Writers Experience
4,80
Delivery
4,90
Support
4,70
Price
Recommended Service
From $13.90 per page
4,6 / 5
4,70
Writers Experience
4,70
Delivery
4,60
Support
4,60
Price
From $20.00 per page
4,5 / 5
4,80
Writers Experience
4,50
Delivery
4,40
Support
4,10
Price
* All Partners were chosen among 50+ writing services by our Customer Satisfaction Team

1Isolation and expansion of human Adipose-derived mesenchymal stem cells:Adipose tissueswere obtained from healthy adult donors undergoing plastic surgery at Taleghanihospital according to procedures approved by theEthics Committee at the Shahid Beheshti University of Medical Sciences.MSCs were isolated as described previously (ref). Briefly to obtain hAD-MSCs,adipose tissues were minced into small pieces and then digested with 0.075%collagenase type I (Gibco) 20 min at 37 ºC under continuous shaking. Thedigested samples were neutralized with Dulbecco modified Eagle medium (DMEM)containing 10% fetal bovine serum (FBS). After centrifugation at 400g for 10min, pellets were suspended and cultured in MSCs complete medium, DMEMsupplemented with 10% FBS and 100 U/ml penicillin/streptomycin, and maintainedin a humidified atmosphere of 5% CO2 at 37 °C.

After 24 hrs, nonadherent cellswere washed and culture medium was changed with fresh one. Every 3-4 days 50%medium was changed with fresh media. When cells reached to optimum confluency,they trypsinized and passed to new culture flasks. For following experimentsthe cells were used at passage 3.2.2Evaluation of MSCs differentiation:Toconfirm that the isolated cells were multipotent, we tested cultures at passage3 for their ability to undergo differentiation into adipocytes and osteocytes.

·        Adipogenesis:For adipogenic differentiation MSCs cultured at a density of 3×104cells/well in 4-well tissue culture plates and next day medium was changed withadipogenic induction medium that containing 5 mM insulin (Sigma-Aldrich), 250nM dexamethasone (Sigma-Aldrich), 100 mM indomethacin (Sigma-Aldrich) and 0.5mM 3-isobutyl-1-methylxanthine (Sigma- Aldrich). Medium was changed every 3days. Approximately, after 21 days, cultures were fixed using formalin solution and Successful differentiation was evaluated by detectingintracellular lipid deposits by Oil Red O staining. Control MSCs cultures weregrown in MSCs complete medium.·        Osteogenesis:The osteogenic differentiation of MSCs was performed by seeding 3×104cells/well in 4-well tissue culture plates in complete medium. The followingday, osteogenic medium containing 10mM ?-glycero phosphate (Merck), 50µM ascorbic acidbiphosphate (Sigma), and 100nM dexamethasone (Sigma) was added. Medium was replaced every 3 days.

At day 21, the cellswere fixed using formalinsolution and osteoblastic differentiation was confirmed by Alizarin redS-staining. Control MSCs cultures were grown in MSCs complete medium.2.3 Flowcytometric analysis of human Adipose-derived mesenchymal stem cells:For Flowcytometric analysis of hAD-MSCs surface markers, the Confluent cells weretrypsinized at passage 3 and washed twice with PBS, then the cells wereincubated at 4ºC for 40 minutes in the dark with the monoclonal antibodiesconjugated with fluorescein isothiocyanate (FITC) or phycoerythrin (PE)including: CD45, CD11b, CD73, CD105, and CD34. Related isotype antibodies wereused as the control (All antibodies were purchased from eBioscience, USA).

Thelabled cells were analyzed using a FACSCaliburflow cytometer (Becton Dickinson, FACScan, San Jose, CA, USA), and dataanalysis was performed using Flowjo 7.6.1.

2.4Construction of Recombinant Vector Harboring Target GeneIn this studywe choosed hsa-miR-29b1 as the target gene. In order to produce stabletransgenic hAD-MSC, we used pLenti-III-miR-GFP (ABM, Canada)  vector (ABM, Canada) that target genes wereexpressed under a CMV promoter and have eGFP for fluorescent tagging andpuromycin for selecting stable transgenic AD-MSCs. Human pre-miR-29b1 flankedby ?100bp on either end was PCR-amplified from genomic DNA using gene-specific primers. Forward and reverseprimers contained XhoI and NotI site,respectivly (the underlined nucleotides show the restriction sites used forcloning) F: CCGCTCGAGTGAACCTTTGTCTGGGCAAC, R: TTTTCCTTTTGCGGCCGCAGACCTGACTGCCATTTGTG. The fragment was then cloned into pLenti-III-GFP at XhoI and Not I site according to standarddigestion-ligation method.

(Or The PCR products werecloned into T vector………….). We verifiedthe pLenti-III-miR-29b1-GFP construct by digestion and subsequent DNAsequencing. pLenti-III-GFP was used as control vector.2.5Lentivirus packaging or Lentivirus constructionand production or virus Production or Retrovirus production andinfectionTo produce the lentiviruses,4×106 HEK293T were plated in T-75 plastic cell culture flasks in DMEMmedium supplemented with 10% FBS, and incubated 24 h to reach the confluency ofapproximately 80%.

2-3 h prior to transfection medium was replaced with 10 ml DMEMmedium with 5% FBS. Calcium phosphate method was used to co-transfection ofHEK293T with transfer vector and helper plasmids; psPAX2 (Addgene, Cambridge, MA)and pMD2.G (Addgene, Cambridge, MA). with the ratio of2:2:1. All solutions were prewarmed, mixed and agitated before use. The transfection conditions for a T75 flask were thefollowing: 21 µg transfer vector, 21 µg psPAX2 and 10.5 µg pMD2.

G were added to33 µl TE 1X, 105 µl CaCl2 (2.5M) and mix up to a total volume of 1050 µl withwater. The mixture was then vortexed while 1050 µl of 2X HBSS buffer (HEPES 50 mM,NaCl 280 mM, Na2HPO4 0.75 mM, NaH2Po4•2H2O 0.

75 mM, pH 7.05) was added dropwise.Transfection solution incubated for 15 minutes at room temperature and added toHEK293T cells.

The cells were incubated in 5% CO2 incubator at 37?C. After 16 hmedium was changed by 7 ml fresh DMEM with 5% FBS. Supernatants were collectedevery 24 h, centrifuged at 500×g for 5 min at 4?C, followed by filtered througha 0.

45µm pore size filter to remove cell debris (Millipore). The viruses wereutilized freshly or aliquted and stored at -80°C.2.

6Transduction of MSCshAD-MSCs werecultured at density of 1×105 cells/ T-25 plastic cell culture flasksin DMEM supplemented with 10% FBS and expanded at 37°C and 5% CO2 overnight toreach the 30% confluency. To perform transduction culture medium was changedwith 3 mL fresh virus supernatant that collected the same day in the presenceof 4 µg/ml polybrene (Sigma). On the next day, transduction was repeated byreplacing of supernatant with another 3 mL of fresh one.

After 24 hours, cellswere washed and cultured in complete media containing 10 % FBS for additional day.Control cell samples were subject to the samemanipulations without adding a virus supernatant or none transduced cells that werecultured in DMEM plus 10% FBS with 4 µg/ml Polybrene were used ascontrol group. 48 hrs later the transductionefficiency was analyzed by fluorescence microscopy andGFP-positive cells were then assessed by flow cytometry.2.7 Flowcytometry Analysis of transduction efficiency or transgeneexpression????Inorder to analysis of Transduction efficiency, transduced and control cells weretrypsinized. After inactivation, cells were washed and resuspendedin PBS and GFP expression were analysed by flow cytometry or FACSCalibur flow cytometer (Becton Dickinson,FACScan, San Jose, CA, USA), and data analysis was performed using Cyflogicsoftware (CyFlo Ltd).2.8RNA extraction and Quantitative RT-PCR or ReverseTranscription Polymerase Chain Reactionor qRT-PCR or RNAextraction and cDNA synthesis: Fourty eighthours after transduction, cells were collected and total RNA was extracted usingTrizol reagent (Life Technologies, USA) according to manufacturer instructions.

After measurment of RNA concentrations by NanoDrop 2000 (Thermo FisherScientific, USA), 1 µg of RNA was reverse-transcribed to cDNA using MMLVreverse transcriptase (Fermentas) and stem loop miR-specific RT primer forhsa-miR-29b1 (????? ???????). Quantitative real-time RT-PCR wasperformed in triplicates on an ABI Step one Systemusing SYBR green master mix (Amplicon). The following conditions was carriedout: an initial incubation 15 min at 95 ?C, followed by 20 s at 95 ?C and 1 minat 60 ?C for 40 cycles. All expression were normalized to U47 as the endogenousreference gene. Relative expression was calculated using 2-??ct (orREST 2009).

2.10Statistical Analysis. All experimentswere performed in triplicates otherwise stated.

Statistical analyses wereevaluated using Microsoft Excel, version 2013 and one-way analysis of variance(ANOVA) using GraphPad Prism 7 program. The difference was consideredsignificant at p < 0.05.      3.RESULTS:3.

1 Morphologicaland differential characteristics of hAD-MSCs:We isolatedhuman MSCs from adipose tissues collected from healthy donor using enzymaticdigestion. Non-adherent cells were washed 24 hrs after primary culture andadherent cells were expanded until 90% confluency. Morphological analysis usinga light microscopoy evaluated that the isolated adherent cells possess spindlefibroblast-like shape (Fig. 1a).

Furthermore, to investigate the multipotentpotential of the cells, we cultured the cells in osteogenic and adipogenicinduction media at passage 3. After 21 days, Oil red O staining of cytoplasmicoil droplets, indicated that MSCs successfully differentiated into adipocytes(Fig. 1b) and calcium deposits of osteocytes were detected using Alizarin red S(Fig. 1c).3.2 Flowcytometric (Surface antigens) characterization of hAD-MSCs:At passage 3, MSCsisolated from human adipose tissues were trypsinized after reaching 90% confluency,produce single cells and examined by flow cytometry for MSCs surface antigens.The isolated cells were positive for MSCs surface markers, CD90, CD73, CD29, CD105,CD73, CD140b, CD146 and CD166, however epithelial and hematopoietic cellmarkers, CD11b, CD31, CD34 and CD45 were not expressed on the cells(Fig. 2).

3.3 Packagingand transfer vectors or Lentiviral construct andrecombinant viral particle production:Tooverexpression of the target gene in hAD-MSCs, we initially cloned hsa-miR-29b1precursor into pLenti-III-miR-GFP vector with XhoI and NotI digestion. PCRamplification using vector universal primers, restriction endonucleasedigestions, and finally DNA sequencing of fragment confirmed that cloning was successful(Fig 3a, b, c). We next produced viral particles by cotransfection of transfervector with helper vector (psPAX2, pMD2.G) to HEK293T. The transfectionefficiency was ~90% (Fig. 4). Every 24 hrs supernatants that contained virusparticles were collected.

3.4High transduction efficiency of Mesenchymal stem cells through modification ofculturing conditions:Sincelentiviral transduction of primary cells is technically challenging, and needsome equipment like ultarcentrifuge to prepare the virus particles, here wechange the transduction conditions for efficient transduction as following: wewere seeded hAD-MSCs at 30% confluency in T-25 plastic cell culture flaskes(Fig. 5a) and cultured them with 4 ml of freshly collected virus supernatant inpresence of 4 µg/ml polybrene.24 hrs later the same procedure was repeated and let to rest then for one day.After 24-48 hrs the cells were examined by fluorescence microscopy and flowcytometry. They demonstrarted that more than 90%of cells were transduced with desired vector (Fig.

5b). 3.5 Flow (GFP)??3.6Target gene expression in transduced adipose derive mesenchymal stem Cells:To further (investigate) confirmation of lentiviral transductionof human adipose derived mesenchymal stem cells, total RNA was extracted fromthese cells and Real-time RT-PCR assay was performed utilizing U47 as a control.Results revealed significant overexpression of mature has-miR-29b in transducedcells compared to that of control groups that transduced with backbonelentiviral vector as control (Fig. 6).       4.

DISCUSSION:Although recentlyMSCs have an increasing attention in gene therapy, However, It has beenchallenging to transfer of exogenous genes into the primary cells (ref). Lentiviralvectors are one of the efficient transfection vehicles for stably integrationof target genes into the genome of both dividing and nondividing cells, butthese method needs to concentrate the viruses and purification of viralparticles by ultracentrifugation that could be an instrumental barrier in thetransduction process because of heavy cost onlaboratories (ref). Currently, several optimized methods have beendescribed to transduce MSCs with or withoutusing ultracentrifugation (ref). Optimization of transduction can be achieve byseveral condition including the use of appropriate viral vectors, improve viralconcentration, initial target cells confluency (ornumber), transduction over multiple days and, use of positively chargedcomponent to introduce the virus to target cell membrane (ref).Despite manystudies have been conducted to achieve different protocols to transfer geneinto MSCs, they usually use another equipment and chemical reagent that causemore charge on researchers (ref). So the aim of the current study was todevelop an alternative efficient and simple method to transduce primary adiposederived-mesenchymal stem cells, significantly withoutneeds to concentration of the virus particles. In this regards, wedecreased virus culture medium to obtain more concentrated viruses and also confluencyof MSCs decreased to 30% at the transduction time.

For increase intransduction efficiency polybrene commonly was added to viral particles (ref),but numerous studies have shown that polybrene can influence MSCs proliferation(ref). So here, weused 5 µl lipofectamine 2000 as positive charged chemical component to reducenegative repulsion between the cell membrane and lentiviruses, without decreasein transduction efficiency. These data are in contractwith the observations of Hodgson and et, al, who studied the effect of liposomeson retroviral transduction.1 Di Nicola et al and Zhang et al also used lipofectamine reagentfor increase transduction of primary T lymphocytes (ref)To sum up, thedata presented here show that our modified method could transduce AD-MSCs 48hours post transduction and the efficiency was more than 90% and our work developa simple method to introduce exogenous gene into adipose derived mesenchymalstem cells without using expensive equipment and proliferation inhibitor.5.ACKNOWLEDGMENTSThis work was supported by research grants of ShahidBeheshti University of Medical Sciences, Tehran, Iran. We would like to thank Ms. Ameneh Kouchaki fortechnical assistance.

 6. CONFLICT OF INTEREST There are neither ethical nor financialconflicts of interest involved in the manuscript.              7.REFERENCES:                  FIGURE LEGENDSFigure 1: Morphology and differentiation ability of adiposederived-mesenchymal stem cells (AD-MSCs)Morphology of human AD-MSCs by light microscopy at passage 2 (20×) showedfibroblast-like cells (A).

After 21 days, adipogenicdifferentiation were assessed by Oil red O staining of oil droplets (B), and osteogenicdifferentiation were verified by staining of calcium deposits with Alizarin Red(C).Figure 2: Flow cytometric analysis of adipose derived-mesenchymalstem cells (AD-MSCs) surface phenotypic markers106 cells were stained with FITC or PE-labeledmonoclonal antibodies to human CD45, CD11b, CD73, CD105, and CD34. Red and bluehistograms displayed isotype control antibodies labeling and surface proteins,respectively.

Data are shown as the mean±SD.Figure 3: Figure 4: Transfection of 293T producer cell lineHEK 293T cells were transfected with plenti-III-miR-GFP and helperplasmid to produce viruses.  16 hoursafter transfection the cells were examined by Light microscopy (A), and fluorescentmicroscopy (B). GFP expression revealed that the rate of transfection was morethan 90%.Figure 5: Transductionof adipocyte-derived mesenchymal stem cells (AD-MSCs) by lentiviruses.

Panel A shows AD-MSCs prior to transduction and Panel B showstransduced AD-MSCs by pCDH-CMV-p28-IRES-EBI3-EF1-copGFP-Pur lentiviral vector.The numerous green cells and GFP expression indicate a high level oftransductionThe comparison of transfection efficiency of mesen- chymal stemcells using various medium conditions. The green fluorescence proteinexpression was evaluated at 24 h post- transfection, (40× magnification)Figure 6: Expression of mature miR-29b in lentiviraltransduced adipose derived-mesenchymal stem cells.The mature level of miR-29b was examined in MSCs isolated fromadipose tissue by qPCR assay. (n=4 each). Data are mean ±S.

E.M. *p<0.05, ***p<0.001. PARANDCO1In addition to the increased cost of transducing MSCs, theinhibition of MSC proliferation is problematic for any therapy that requiressufficient cells to repopulate a host PARANDCO2In addition,this study implied that Lipofectamine is a superb additive to enhance thetransduction efficiency of a retrovirus via a specific virus envelopeprotein-receptor interaction for virus entry, and that receptor-mediatedendocytosis does not seem to be the leading route of virus delivery to liberatea virus genome

x

Hi!
I'm Dora!

Would you like to get a custom essay? How about receiving a customized one?

Click here